//Written by Paul Stothard, University of Alberta, Canada

function addReturns (sequence) {
	sequence = sequence.replace(/(.{60})/g, 
                    function (str, p1, offset, s) {
                      	return p1 + "\n";
                   }
        );
	return sequence;
}

function checkAlign (arrayOfTitles, arrayOfSequences)	{
	var lengthOfAlign = arrayOfSequences[0].length;
	if (arrayOfSequences.length < 2)	{
		alert ("Please enter an alignment consisting of at least two sequences.");
		return false;
	}
	for (var i = 0; i < arrayOfTitles.length; i++)	{
		if ((arrayOfTitles[i].search(/\S/) == -1) || (arrayOfSequences[i].search(/\S/) == -1) || (arrayOfSequences[i].length != lengthOfAlign))	{
			alert ("There is a problem with the alignment format.");
			return false;
		}
	}
	return true;
}

function checkCodonTable (codonTable)	{
	if ((codonTable.search(/AmAcid/) == -1) || (codonTable.search(/Codon/) == -1) || (codonTable.search(/Number/) == -1) || (codonTable.search(/\/1000/) == -1) || (codonTable.search(/Fraction\s*\.\./) == -1)) {
		alert ("The codon table has been entered incorrectly.");
		return false;
	}
	return true;
}

function checkFormElement (formElement)	{
    	if (formElement.value.search(/\S/) == -1)	{
		alert ("Please enter some text.");
 		return false;
    	}
    	return true;
}

function checkGeneticCode (arrayOfPatterns)	{
	var z = 0;
	var codon = "";
	var oneMatch = false;
	var testSequence = "gggggaggtggcgaggaagatgacgtggtagttgtcgcggcagctgccaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatcacctgctacttctcccgccacctccc";
	while (z < arrayOfPatterns.length)	{
		if (arrayOfPatterns[z].search(/^\s*\/[a-zA-Z\|\[\]]+\/=[a-zA-Z\*]/) == -1)	{
			alert ("Genetic code error: one or more patterns have been entered incorrectly.");
			return false;
		}
		if (moreExpressionCheck(arrayOfPatterns[z]) == false)	{
			alert ("Genetic code error: one or more patterns have been entered incorrectly.");
			return false;
		}
		z = z + 1;
	}
	var geneticCodeMatchResult = new Array (arrayOfPatterns.length);
	var geneticCodeMatchExp = new Array (arrayOfPatterns.length);
	for (var j = 0; j < arrayOfPatterns.length; j++)	{
			geneticCodeMatchExp[j] = eval(arrayOfPatterns[j].match(/\/.+\//) + "gi");
			geneticCodeMatchResult[j] = (arrayOfPatterns[j].match(/=[a-zA-Z\*]/)).toString();
			geneticCodeMatchResult[j] = geneticCodeMatchResult[j].replace(/=/g,"");
	}
	for (var i = 0; i <= testSequence.length - 3; i = i + 3)	{
		codon = testSequence.substring(i,(i+3));
		for (var j = 0; j < geneticCodeMatchExp.length; j++)	{
			if (codon.search(geneticCodeMatchExp[j]) != -1)	{
				if (oneMatch == true)	{
					alert('Genetic code error: more than one amino acid is coded by the codon: ' + codon + ".");
					return false;
				}
				oneMatch = true;
			}
		}
		if (oneMatch == false)	{
			alert('The genetic code expressions are missing a codon.');
			return false;
		}
		oneMatch = false;
	}
	return true;
}

function checkGroupInput (arrayOfPatterns)	{
	var z = 0;
	while (z < arrayOfPatterns.length)	{
		if (arrayOfPatterns[z].search(/[^acdefghiklmnpqrstvwyz]/i) != -1)	{	
			alert ("One or more groups have been entered incorrectly.");
			return false;
		}
		z = z + 1;
	}
	for (var i = 0; i < arrayOfPatterns.length; i++)	{
		var re = new RegExp ("[" + arrayOfPatterns[i] + "]","gi");
		for (var j = i + 1; j < arrayOfPatterns.length; j++)	{
			if (arrayOfPatterns[j].search(re) != -1)	{
				alert('The same amino acid is in more than one similarity group.');
				return false;
			}
		}
	}
	return true;
}

function checkRestPatterns (arrayOfPatterns)	{
	var z = 0;
	while (z < arrayOfPatterns.length)	{
		if (arrayOfPatterns[z].search(/^\s*\/[acgturyswkmbdhvn\[\]]+\/\s+\([^\/]+\)\d+/i) == -1)	{
			alert ("One or more patterns have been entered incorrectly.");
			return false;
		}
		if (moreExpressionCheck(arrayOfPatterns[z]) == false)	{
			alert ("One or more patterns have been entered incorrectly.");
			return false;
		}
		z = z + 1;
	}
	return true;
}

function checkSequenceLength (text, maxInput) {
	if ( ((getSequenceFromFasta(text)).replace(/[^A-Za-z]/g, "")).length > maxInput) {
		alert ("Please enter a sequence consisting of less than or equal to " + maxInput + " characters.");
		return false;
	}
	else {
		return true;
	}
}

function checkTextLength (text, maxInput) {
	if (text.length > maxInput) {
		alert ("Please enter text consisting of less than or equal to " + maxInput + " characters.");
		return false;
	}
	else {
		return true;
	}
}


function complement (dnaSequence)	{
	//there is no tr operator
	//should write a tr method to replace this
	dnaSequence = dnaSequence.replace(/g/g,"1");
	dnaSequence = dnaSequence.replace(/c/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"c");
	dnaSequence = dnaSequence.replace(/2/g,"g");
	dnaSequence = dnaSequence.replace(/G/g,"1");
	dnaSequence = dnaSequence.replace(/C/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"C");
	dnaSequence = dnaSequence.replace(/2/g,"G");	

	dnaSequence = dnaSequence.replace(/a/g,"1");
	dnaSequence = dnaSequence.replace(/t/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"t");
	dnaSequence = dnaSequence.replace(/2/g,"a");
	dnaSequence = dnaSequence.replace(/A/g,"1");
	dnaSequence = dnaSequence.replace(/T/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"T");
	dnaSequence = dnaSequence.replace(/2/g,"A");

	dnaSequence = dnaSequence.replace(/u/g,"a");
	dnaSequence = dnaSequence.replace(/U/g,"A");

	dnaSequence = dnaSequence.replace(/r/g,"1");
	dnaSequence = dnaSequence.replace(/y/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"y");
	dnaSequence = dnaSequence.replace(/2/g,"r");
	dnaSequence = dnaSequence.replace(/R/g,"1");
	dnaSequence = dnaSequence.replace(/Y/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"Y");
	dnaSequence = dnaSequence.replace(/2/g,"R");	

	dnaSequence = dnaSequence.replace(/k/g,"1");
	dnaSequence = dnaSequence.replace(/m/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"m");
	dnaSequence = dnaSequence.replace(/2/g,"k");
	dnaSequence = dnaSequence.replace(/K/g,"1");
	dnaSequence = dnaSequence.replace(/M/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"M");
	dnaSequence = dnaSequence.replace(/2/g,"K");

	dnaSequence = dnaSequence.replace(/b/g,"1");
	dnaSequence = dnaSequence.replace(/v/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"v");
	dnaSequence = dnaSequence.replace(/2/g,"b");
	dnaSequence = dnaSequence.replace(/B/g,"1");
	dnaSequence = dnaSequence.replace(/V/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"V");
	dnaSequence = dnaSequence.replace(/2/g,"B");

	dnaSequence = dnaSequence.replace(/d/g,"1");
	dnaSequence = dnaSequence.replace(/h/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"h");
	dnaSequence = dnaSequence.replace(/2/g,"d");
	dnaSequence = dnaSequence.replace(/D/g,"1");
	dnaSequence = dnaSequence.replace(/H/g,"2");
	dnaSequence = dnaSequence.replace(/1/g,"H");
	dnaSequence = dnaSequence.replace(/2/g,"D");
		
	return dnaSequence;
}

function closeForm ()	{
	outputWindow.document.write ("</form>");
	return true;
}

function closePre () {
	//this is needed for Internet Explorer bug
	outputWindow.document.write ("</div>");
	outputWindow.document.write ('</pre>\n');
}

function closeTextArea ()	{
	outputWindow.document.write ('</textarea>');
	return true;
}

function closeWindow ()	{
	outputWindow.document.write ("<img style=\"border:0;width:88px;height:31px\" src=\"includes/valid-xhtml10.png\" alt=\"Valid XHTML 1.0!\" height=\"31\" width=\"88\" />\n");
	outputWindow.document.write ("<img style=\"border:0;width:88px;height:31px\" src=\"includes/vcss.png\" alt=\"Valid CSS!\" />\n");
	outputWindow.document.write ("</body>\n</html>\n");
	outputWindow.status = 'Done.';
	outputWindow.document.close();
	return true;
}

function convertDegenerates (sequence) {
	sequence = sequence.toLowerCase();
	sequence = sequence.replace(/t/g, "[TU]");
	sequence = sequence.replace(/r/g, "[AGR]");
	sequence = sequence.replace(/y/g, "[CTUY]");
	sequence = sequence.replace(/s/g, "[GCS]");
	sequence = sequence.replace(/w/g, "[ATUW]");
	sequence = sequence.replace(/k/g, "[GTUK]");
	sequence = sequence.replace(/m/g, "[ACM]");
	sequence = sequence.replace(/b/g, "[CGTUBSKY]");
	sequence = sequence.replace(/d/g, "[AGTUDRKW]");
	sequence = sequence.replace(/h/g, "[ACTUHMYW]");	
	sequence = sequence.replace(/v/g, "[ACGVSMR]");
	sequence = sequence.replace(/n/g, "[ACGTURYSWKMBDHVN]");
	return sequence;	
}

function earlyCheckAlign (alignArray)	{
	if (alignArray.length < 3)	{
		alert ("There is a problem with the alignment format.");
		return false;
	}
	for (var i = 1; i < alignArray.length; i++)	{
		if (alignArray[i].search(/[^\s]+\s/) == -1)	{
			alert ("There is a problem with the alignment format.");
			return false;
		}
	}
	return true;
}

function filterAlignSeq (alignSeq)	{
	alignSeq = alignSeq.replace(/[^acdefghiklmnpqrstvwyx\.\-]/gi,"");
	return alignSeq;
}


function filterFastaTitle (sequenceTitle)	{
	sequenceTitle = sequenceTitle.replace(/\s{2,}/g," ");
	sequenceTitle = sequenceTitle.replace(/^\s*/g,"");
	sequenceTitle = sequenceTitle.replace(/[\f\n\r\t]+$/g,"\n");
	return sequenceTitle.replace (/[\<\>]\n/gi,"");
}

function getArrayOfFasta (sequenceData) {
	var arrayOfFasta = new Array();
	var matchArray;
	var re = /\>[^\>]+/g;
	if (sequenceData.search(/\>[^\f\n\r]+[\f\n\r]/) != -1)	{
		while (matchArray = re.exec(sequenceData)) {
			arrayOfFasta.push(matchArray[0]);
		}		
	}
	else {
		arrayOfFasta[0] = sequenceData;
	}
	return arrayOfFasta;
}

function getFastaTitleFromTitleAndSequence (fastaSequenceTitle, sequence)	{
	var stringToReturn = '&gt;results for ' + sequence.length + ' residue sequence ';
	if (fastaSequenceTitle.search(/[^\s]/) != -1)	{
		stringToReturn = stringToReturn + '"' + fastaSequenceTitle + '"';
	}
	stringToReturn = stringToReturn + ' starting "' + sequence.substring(0,10) + '"';
	return stringToReturn + '\n';
}

function getFuzzySearchTitle (fastaSequenceTitleOne, sequenceOne, fastaSequenceTitleTwo, sequenceTwo)	{
	var stringToReturn = 'Search results for ' + sequenceOne.length + ' residue sequence ';
	if (fastaSequenceTitleOne.search(/[^\s]/) != -1)	{
		stringToReturn = stringToReturn + '"' + fastaSequenceTitleOne + '"';
	}
	stringToReturn = stringToReturn + ' starting "' + sequenceOne.substring(0,10) + '"\n';
	stringToReturn = stringToReturn + 'and ' + sequenceTwo.length + ' residue sequence ';
	if (fastaSequenceTitleTwo.search(/[^\s]/) != -1)	{
		stringToReturn = stringToReturn + '"' + fastaSequenceTitleTwo + '"';
	}
	stringToReturn = stringToReturn + ' starting "' + sequenceTwo.substring(0,10) + '"';
	return '<div class="info">' + stringToReturn + '</div>\n';
}

function getGeneticCodeMatchExp (arrayOfPatterns) {
	var geneticCodeMatchExp = new Array (arrayOfPatterns.length);
	for (var j = 0; j < arrayOfPatterns.length; j++)	{
			geneticCodeMatchExp[j] = eval(arrayOfPatterns[j].match(/\/.+\//) + "gi");
	}
	return geneticCodeMatchExp;
}

function getGeneticCodeMatchResult (arrayOfPatterns) {
	var geneticCodeMatchResult = new Array (arrayOfPatterns.length);
	for (var j = 0; j < arrayOfPatterns.length; j++)	{
			geneticCodeMatchResult[j] = (arrayOfPatterns[j].match(/=[a-zA-Z\*]/)).toString();
			geneticCodeMatchResult[j] = geneticCodeMatchResult[j].replace(/=/g,"");			
	}
	return geneticCodeMatchResult;
}

function getInfoFromTitleAndSequence (fastaSequenceTitle, sequence)	{
	var stringToReturn = 'Results for ' + sequence.length + ' residue sequence ';
	if (fastaSequenceTitle.search(/[^\s]/) != -1)	{
		stringToReturn = stringToReturn + '"' + fastaSequenceTitle + '"';
	}
	stringToReturn = stringToReturn + ' starting "' + sequence.substring(0,10) + '"';
	return '<div class="info">' + stringToReturn + '</div>\n';
}

function getInfoFromTitleAndSequenceAndTopology (fastaSequenceTitle, sequence, topology)	{
	var stringToReturn = 'Results for ' + topology + ' ' + sequence.length + ' residue sequence ';
	if (fastaSequenceTitle.search(/[^\s]/) != -1)	{
		stringToReturn = stringToReturn + '"' + fastaSequenceTitle + '"';
	}
	stringToReturn = stringToReturn + ' starting "' + sequence.substring(0,10) + '"';
	return '<div class="info">' + stringToReturn + '</div>\n';
}

function getPairwiseAlignTitle (fastaSequenceTitleOne, sequenceOne, fastaSequenceTitleTwo, sequenceTwo)	{
	var stringToReturn = 'Alignment results for ' + sequenceOne.length + ' residue sequence ';
	if (fastaSequenceTitleOne.search(/[^\s]/) != -1)	{
		stringToReturn = stringToReturn + '"' + fastaSequenceTitleOne + '"';
	}
	stringToReturn = stringToReturn + ' starting "' + sequenceOne.substring(0,10) + '"\n';
	stringToReturn = stringToReturn + 'and ' + sequenceTwo.length + ' residue sequence ';
	if (fastaSequenceTitleTwo.search(/[^\s]/) != -1)	{
		stringToReturn = stringToReturn + '"' + fastaSequenceTitleTwo + '"';
	}
	stringToReturn = stringToReturn + ' starting "' + sequenceTwo.substring(0,10) + '"';
	return '<div class="info">' + stringToReturn + '</div>\n';
}

function getRandomSequence (components, lengthOut)	{
	var sequenceArray = new Array();
	var tempNum = 0;
	var tempChar = "";
	for (var j = 0; j < (lengthOut); j++)	{
		tempNum = Math.floor(Math.random() * components.length);
		tempChar = components[tempNum];
		sequenceArray.push(tempChar);
	}
	return sequenceArray.join("");
}

function getSequenceFromFasta (sequenceRecord) {
	if (sequenceRecord.search(/\>[^\f\n\r]+[\f\n\r]/) != -1)	{
		sequenceRecord = sequenceRecord.replace(/\>[^\f\n\r]+[\f\n\r]/,"");
	}
	return sequenceRecord;
}

function getTitleFromFasta (sequenceRecord) {
	var fastaTitle = "Untitled";
	if (sequenceRecord.search(/\>[^\f\n\r]+[\f\n\r]/) != -1)	{
		fastaTitle = (sequenceRecord.match(/\>[^\f\n\r]+[\f\n\r]/,"")).toString();
		fastaTitle = fastaTitle.replace(/\>|[\f\n\r]/g,"");
		fastaTitle = fastaTitle.replace(/\s{2,}/g," ");
	        fastaTitle = fastaTitle.replace(/[\<\>]/gi,"");
	}
	return fastaTitle;
}

function moreExpressionCheck (expressionToCheck)	{
	if ((expressionToCheck.search(/\[[A-Za-z\|]*\[/) != -1) || (expressionToCheck.search(/\][A-Za-z\|]*\]/) != -1) || (expressionToCheck.search(/\[\]/) != -1) || (expressionToCheck.search(/\/[A-Za-z\|]*\]/) != -1) || (expressionToCheck.search(/\[[A-Za-z\|]*\//) != -1) || (expressionToCheck.search(/\|\|/) != -1) || (expressionToCheck.search(/\/\|/) != -1) || (expressionToCheck.search(/\|\//) != -1) || (expressionToCheck.search(/\[.\]/) != -1) || (expressionToCheck.search(/\</) != -1) || (expressionToCheck.search(/\>/) != -1))	{
		return false;
	}
	return true;
}

function openForm ()	{
	outputWindow.document.write ('<form action="">\n');
	return true;
}

function openPre () {
	//this is needed for Internet Explorer bug
	outputWindow.document.write ('<pre>');
	outputWindow.document.write ('<div class="pre">');	
}

function openTextArea ()	{
	outputWindow.document.write ('<br /><textarea rows="6" cols="61">\n');
	return true;
}

function openWindow (title) {

	outputWindow=window.open("","my_new_window","toolbar=no, location=no, directories=no, status=yes, menubar=yes, scrollbars=yes, resizable=yes, copyhistory=no, width=800, height=400");
	outputWindow.focus();
	outputWindow.document.write ("<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Transitional//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd\">\n" +
			             "<html lang=\"en\">\n" +
				     "<head>\n" +
                                     "<title>Sequence Manipulation Suite</title>\n" +                         
                                     "<meta http-equiv=\"Content-Type\" content=\"text/html; charset=ISO-8859-1\" />\n" +
                                     "<style type=\"text/css\" media=\"screen\">\n" +
				     "body.main {font-size: medium; font-family: arial, sans-serif; color: #000000; background-color: #FFFFFF}\n" +
			             "div.pre {font-size: medium; color: #000000; font-family: courier, sans-serif; white-space: pre}\n" +
				     "div.title {font-size: x-large; color: #000000; text-align: left; background-color: #FFFFFF}\n" +
				     "div.info {font-weight: bold}\n" +	
				     "span.none, td.none {color: #000000; background-color: #FFFFFF}\n" +
			             "span.one, td.one {color: #000000; background-color: #66FF00}\n" +
				     "span.two, td.two {color: #000000; background-color: #FFFF66}\n" +	
				     "span.three, td.three {color: #000000; background-color: #FFFFFF}\n" +
				     "span.forward_primer, td.forward_primer {color: #000000; background-color: #FF66FF}\n" +
				     "span.reverse_primer, td.reverse_primer {color: #000000; background-color: #FF9933}\n" +
				     "span.current_sequence {color: #000000; background-color: #FFFFFF}\n" +
				     "span.mutated_sequence {color: #990066; background-color: #FFFFFF}\n" +
				     "td.many {color: #000000}\n" +
				     "td.title {font-weight: bold; color: #000000; background-color: #FFFFFF}\n" +
				     "</style>\n" +
                                     "<style type=\"text/css\" media=\"print\">\n" +
				     "body.main {font-size: medium; font-family: arial, sans-serif; color: #000000; background-color: #FFFFFF; margin: 0 auto; padding: 0}\n" +
			             "div.pre {font-size: medium; color: #000000; background-color: #FFFFFF; font-family: courier, sans-serif; white-space: pre}\n" +
				     "div.title {display: none}\n" +
				     "div.info {font-weight: bold}\n" +	
				     "span.none, td.none {color: #000000; background-color: #FFFFFF}\n" +
			             "span.one, td.one {color: #000000; text-decoration: underline; background-color: #FFFFFF}\n" +
				     "span.two, td.two {color: #000000; font-style: italic; background-color: #FFFFFF}\n" +	
				     "span.three, td.three {color: #000000; background-color: #FFFFFF}\n" +
				     "span.forward_primer, td.forward_primer {color: #000000; background-color: #FFFFFF}\n" +
				     "span.reverse_primer, td.reverse_primer {color: #000000; background-color: #FFFFFF}\n" +
				     "span.current_sequence {color: #000000; background-color: #FFFFFF}\n" +
				     "span.mutated_sequence {color: #000000; text-decoration: underline; background-color: #FFFFFF}\n" +
				     "td.many {color: #000000; background-color: #FFFFFF}\n" +
				     "td.title {font-weight: bold; color: #000000; background-color: #FFFFFF}\n" +
				     "img {display: none}\n" +
				     "</style>\n" +
                                     "</head>\n" +
                                     "<body class=\"main\">\n" +
                                     "<div class=\"title\">" + title + " results</div>\n");
	outputWindow.status = 'Please Wait.';
	return true;
}

function openWindowAlign (title) {

	outputWindow=window.open("","my_new_window","toolbar=no, location=no, directories=no, status=yes, menubar=yes, scrollbars=yes, resizable=yes, copyhistory=no, width=800, height=400");
	outputWindow.focus();
	outputWindow.document.write ("<!DOCTYPE html PUBLIC \"-//W3C//DTD XHTML 1.0 Transitional//EN\" \"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd\">\n" +
			             "<html lang=\"en\">\n" +
				     "<head>\n" +
                                     "<title>Sequence Manipulation Suite</title>\n" +                         
                                     "<meta http-equiv=\"Content-Type\" content=\"text/html; charset=ISO-8859-1\" />\n" +
                                     "<style type=\"text/css\" media=\"screen\">\n" +
				     "body.main {font-family: arial, sans-serif; color: #000000; background-color: #FFFFFF}\n" +
			             "div.pre {font-size: medium; color: #000000; font-family: courier, sans-serif; white-space: pre}\n" +
				     "div.title {font-size: x-large; color: #000000; text-align: left; background-color: #FFFFFF}\n" +
				     "div.info {font-weight: bold}\n" +	
 				     "span.ident {color: #FFFFFF; background-color: #000000}\n" +
				     "span.sim {color: #FFFFFF; background-color: #666666}\n" +
				     "span.g, span.a, span.v, span.l, span.i {color: #000000; background-color: #C0C0C0}\n" +
				     "span.f, span.y, span.w {color: #000000; background-color: #FF9900}\n" +
			             "span.c, span.m {color: #000000; background-color: #FFFF00}\n" +
				     "span.s, span.t {color: #000000; background-color: #66FF00}\n" +
				     "span.k, span.r, span.h {color: #000000; background-color: #FF0000}\n" +
				     "span.d, span.e, span.n, span.q {color: #000000; background-color: #33CCFF}\n" +
			             "span.p {color: #000000; background-color: #FF99FF}\n" +
				     "</style>\n" +
                                     "<style type=\"text/css\" media=\"print\">\n" +
				     "body.main {font-family: arial, sans-serif; color: #000000; background-color: #FFFFFF}\n" +
			             "div.pre {font-size: medium; color: #000000; font-family: courier, sans-serif; white-space: pre}\n" +
				     "div.title {display: none}\n" +
				     "div.info {font-weight: bold}\n" +	
 				     "span.ident {color: #000000; font-weight: bold; text-decoration: underline; background-color: #FFFFFF}\n" +
				     "span.sim {color: #000000; font-weight: bold; background-color: #FFFFFF}\n" +
				     "span.diff {color: #999999; background-color: #FFFFFF}\n" +
				     "span.g, span.a, span.v, span.l, span.i {color: #CC33CC; background-color: #FFFFFF}\n" +
				     "span.f, span.y, span.w {color: #996600; background-color: #FFFFFF}\n" +
			             "span.c, span.m {color: #FFCC00; background-color: #FFFFFF}\n" +
				     "span.s, span.t {color: #CCFF00; background-color: #FFFFFF}\n" +
				     "span.k, span.r, span.h {color: #FF0000; background-color: #FFFFFF}\n" +
				     "span.d, span.e, span.n, span.q {color: #0000FF; background-color: #FFFFFF}\n" +
			             "span.p {color: #00FFCC; background-color: #FFFFFF}\n" +
				     "img {display: none}\n" +
				     "</style>\n" +
                                     "</head>\n" +
                                     "<body class=\"main\">\n" +
                                     "<div class=\"title\">" + title + " results</div>\n");
	outputWindow.status = 'Please Wait.';
	return true;
}

	
function removeNonDna (sequence) {
	return sequence.replace(/[^gatucryswkmbdhvnxGATUCRYSWKMBDHVNX]/g, "");
}

function removeNonDnaStrict (sequence) {
	return sequence.replace(/[^gatucGATUC]/g, "");
}

function removeNonProtein (sequence) {
	return sequence.replace(/[^ACDEFGHIKLMNPQRSTVWYZacdefghiklmnpqrstvwyz\*]/g, "");
}

function removeNonProteinStrict (sequence) {
	return sequence.replace(/[^ACDEFGHIKLMNPQRSTVWYZacdefghiklmnpqrstvwyz\*]/g, "");
}

function removeWhiteSpace (text) {
	return text.replace(/\s/g, "");
}

function removeNonLetters (sequence) {
	return sequence.replace(/[^A-Z]/gi, "");
}

function reverse (dnaSequence)	{	
	var tempDnaArray = new Array();
	if (dnaSequence.search(/./) != -1)	{
		tempDnaArray = dnaSequence.match(/./g);
		tempDnaArray = tempDnaArray.reverse();
		dnaSequence = tempDnaArray.join("");
	}
	return dnaSequence;
}

function rightNum (theNumber, sequenceToAppend, lengthOfColumn, tabIn)	{
	var j = 0;
	var tempString = "";
	theNumber = theNumber.toString();
	for (var j = theNumber.length; j < lengthOfColumn; j++)	{
		tempString = tempString + " ";
	}
	theNumber = tempString + theNumber + " ";
	sequenceToAppend = sequenceToAppend + theNumber + tabIn;
	return sequenceToAppend;
}

function testScript() {
	//test some javascript functions to see how the browser performs. 
	//want to prevent non Javascript 1.5 browsers from attempting to run.
	//first test Array.push()
	var testArray = new Array();
	var testString = "1234567890";
	
	testArray.push(testString);
	if (testArray[0] != testString) {
		alert("Array object push method not supported. See browser compatibility page.");
		return false;
	}

	//now test the 'm' flag in a regular expression
	testString = "1\n2\n3";
	var re = /^2$/m;
	if (testString.search(re) == -1) {
		alert("Regular expression 'm' flag not supported. See browser compatibility page.");
		return false;
	}

	var caughtException = false;
	//now test exception handling
	try {
		re = eval("Exception handling not supported. Check browser compatibility page.");
	}
	catch(e) {
		caughtException = true;
	}

	if (!(caughtException)) {
		alert("Exception handling not supported. See browser compatibility page.");
	}

	//now test replace lambda function
	testString = "123";	
	testString = testString.replace(/(\d)/g, 
                    function (str, p1, offset, s) {
                      	return p1 + "X";
                   }
        );
	if (testString != "1X2X3X") {
		alert ("Nested function in String replace method not supported. See browser compatibility page.");
		return false;
	}

	//test number methods toFixed() and toPrecision()
	var testNum = 2489.8237;
	if (testNum.toFixed(3) != 2489.824) {
		alert ("Number toFixed() method not supported. See browser compatibility page.");
		return false;
	}

	if (testNum.toPrecision(5) != 2489.8) {
		alert ("Number toPrecision() method not supported. See browser compatibility page.");
		return false;
	}

	return true;
}

function verifyDigits (theNumber)	{
	if (theNumber.search(/\d/) == -1) {
		alert ("Please enter a number");
		return false;
	}
}

function verifyEmbl (emblFile) {
	if ((emblFile.search(/ID/) == -1) || (emblFile.search(/AC/) == -1) || (emblFile.search(/DE/) == -1) || (emblFile.search(/SQ/) == -1)) {
		alert ("Please enter the contents of an EMBL file.");
		return false;
	}
	return true;
}

function verifyMaxDigits (theNumber, maxInput)	{
	if (theNumber.search(/\d/) == -1) {
		alert ("Please enter a number.");
		return false;
	}
	if (theNumber > maxInput) {
	        alert ("Please enter a number less than or equal to " + maxInput + ".");
	        return false;
        }
}

function verifyDna (dnaSequence)	{
	if (dnaSequence.search(/[^gatucryswkmbdhvnx\s]/i) != -1) {	
		alert ("The sequence contains non-DNA characters, which will be omitted.");
	}
	return true;
}

function verifyProtein (proteinSequence)	{
	if (proteinSequence.search(/[^acdefghiklmnpqrstvwyz\*\s]/i) != -1) {	
		alert ("The sequence contains non-protein characters, which will be omitted.");
	}
	return true;
}

function verifyGenBank (genBankFile) {
	if ((genBankFile.search(/LOCUS/) == -1) || (genBankFile.search(/DEFINITION/) == -1) || (genBankFile.search(/ACCESSION/) == -1) || (genBankFile.search(/ORIGIN/) == -1)) {
		alert ("Please enter the contents of a GenBank file.");
		return false;
	}
	return true;
}

function verifyGenBankFeat (genBankFile) {
	if ((genBankFile.search(/LOCUS/) == -1) || (genBankFile.search(/DEFINITION/) == -1) || (genBankFile.search(/ACCESSION/) == -1) || (genBankFile.search(/ORIGIN/) == -1)) {
		alert ("Please enter the contents of a GenBank file.");
		return false;
	}
	if (genBankFile.search(/FEATURES {13}/) == -1)	{
		alert ("The file has no defined features.");
		return false;
	}
	return true;
}

function verifyEmblFeat (emblFile) {
	if ((emblFile.search(/ID/) == -1) || (emblFile.search(/AC/) == -1) || (emblFile.search(/DE/) == -1) || (emblFile.search(/SQ/) == -1)) {
		alert ("Please enter the contents of an EMBL file.");
		return false;
	}
	if (emblFile.search(/^FT/m) == -1)	{
		alert ("The file has no defined features.");
		return false;
	}
	return true;
}

//deprecated                        
function writeGroupNum (text, tabIn, groupSize, basePerLine, startBase, stopBase) {
	var i = startBase;
	var k = 0;
	var lineOfText = "";
	var sepChar = " ";
	groupSize = parseInt(groupSize);
	basePerLine = parseInt(basePerLine);
	while (i < stopBase)	{
		lineOfText = rightNum(i + 1,lineOfText,8,tabIn);
		for (var j = 1; j <= (basePerLine/groupSize); j++)	{//makes a group each loop
			while (k < groupSize)	{
				lineOfText = lineOfText + text.charAt(k + i);
				k = k + 1;
			}
			i = i + groupSize;
			k = 0;
			lineOfText = lineOfText + sepChar;
		}
		outputWindow.document.write (lineOfText + "\n");
		lineOfText = "";
	}
	return true;
}

function writeGroupNumDna (text, tabIn, groupSize, basePerLine, startBase, stopBase, strands, numberPosition) {
	//strands can be 'one' or 'two'
	//numberPosition can be 'left', 'above', or 'right'
	var i = startBase;
	var k = 0;
	var lineOfText = "";
	var lineNum = "";
	var sepChar = " ";
	var aboveNum = "";
	groupSize = parseInt(groupSize);
	basePerLine = parseInt(basePerLine);
	while (i < stopBase)	{
		lineNum = i + 1;
		for (var j = 1; j <= (basePerLine/groupSize); j++)	{//makes a group each loop
			while (k < groupSize)	{
				if (i + k >= stopBase) {
					break;
				}
				lineOfText = lineOfText + text.charAt(k + i);
				k = k + 1;
			}
			lineOfText = lineOfText + sepChar;
			i = i + k;
			if (numberPosition == 'above') {
				aboveNum = aboveNum + rightNum(i,"",groupSize,tabIn);
			}
			if (i >= stopBase) {
				break;
			}
			k = 0;
		}
		if (numberPosition == 'left') {
			outputWindow.document.write (rightNum(lineNum,"",8,tabIn) + lineOfText + "\n");
			if (strands == 'two') {	
				outputWindow.document.write (rightNum(lineNum,"",8,tabIn) + complement(lineOfText) + "\n");
				outputWindow.document.write ("\n");
			}
		}
		else if (numberPosition == 'right') {
			outputWindow.document.write (lineOfText + i + "\n");
			if (strands == 'two') {	
				outputWindow.document.write (complement(lineOfText) + i + "\n");
				outputWindow.document.write ("\n");
			}		
		}
		else if (numberPosition == 'above') {
			outputWindow.document.write (aboveNum + "\n");
			outputWindow.document.write (lineOfText + "\n");
			if (strands == 'two') {	
				outputWindow.document.write (complement(lineOfText) + "\n");
				outputWindow.document.write ("\n");
			}		
		}
		aboveNum = "";
		lineOfText = "";
	}
	return true;
}

function writeGroupNumProtein (text, tabIn, groupSize, basePerLine, startBase, stopBase, numberPosition) {
	//numberPosition can be 'left', 'above', or 'right'
	var i = startBase;
	var k = 0;
	var lineOfText = "";
	var lineNum = "";
	var sepChar = " ";
	var aboveNum = "";
	groupSize = parseInt(groupSize);
	basePerLine = parseInt(basePerLine);
	while (i < stopBase)	{
		lineNum = i + 1;
		for (var j = 1; j <= (basePerLine/groupSize); j++)	{//makes a group each loop
			while (k < groupSize)	{
				if (i + k >= stopBase) {
					break;
				}
				lineOfText = lineOfText + text.charAt(k + i);
				k = k + 1;
			}
			lineOfText = lineOfText + sepChar;
			i = i + k;
			if (numberPosition == 'above') {
				aboveNum = aboveNum + rightNum(i,"",groupSize,tabIn);
			}
			if (i >= stopBase) {
				break;
			}
			k = 0;
		}
		if (numberPosition == 'left') {
			outputWindow.document.write (rightNum(lineNum,"",8,tabIn) + lineOfText + "\n");
		}
		else if (numberPosition == 'right') {
			outputWindow.document.write (lineOfText + i + "\n");		
		}
		else if (numberPosition == 'above') {
			outputWindow.document.write (aboveNum + "\n");
			outputWindow.document.write (lineOfText + "\n");		
		}
		aboveNum = "";
		lineOfText = "";
	}
	return true;
}

function writeMutatedSequence (sequence, components, numMut, firstIndexToMutate, lastIndexToMutate)	{
	var currentChar = "";
	var randNum = 0;
	var maxNum = 0;
	var needNewChar = "";
	var componentsIndex = 0;

	numMut = parseInt(numMut);
	firstIndexToMutate = parseInt(firstIndexToMutate);
	lastIndexToMutate = parseInt(lastIndexToMutate);
	
	if ((sequence.length <= firstIndexToMutate) || (lastIndexToMutate < 0) || (lastIndexToMutate <= firstIndexToMutate)) {
		numMut = 0;
	}

	for (var i = 0; i < numMut; i++)	{
		maxNum = sequence.length;
		randNum = Math.floor(Math.random() * maxNum);
	
		if ((randNum < firstIndexToMutate) || (randNum > lastIndexToMutate)) {
			numMut++;
			continue;
		}
	
		currentChar = sequence.charAt(randNum);
		needNewChar = true;
		while (needNewChar) {
			componentsIndex = Math.round(Math.random() * components.length);
			if (componentsIndex == components.length)	{
				componentsIndex = 0;
			}
			if (components[componentsIndex] != currentChar) {
				needNewChar = false;	
			}			
		}
		sequence = sequence.substring(0,randNum) + components[componentsIndex] + sequence.substring((randNum + 1),sequence.length);

	}
	outputWindow.document.write(addReturns(sequence));
	return true;
}

function writeRandomSequence (components, lengthOut)	{
	var sequence = "";
	var tempNum = 0;
	var tempChar = "";
	for (var j = 0; j < (lengthOut); j++)	{
		tempNum = Math.floor(Math.random() * components.length);
		tempChar = components[tempNum];
		sequence = sequence + tempChar;
		if (sequence.length == 60)	{
			outputWindow.document.write(sequence +'\n');
			sequence = "";
		}
	}
	outputWindow.document.write(sequence + '\n');
	return true;
}

function writeRestrictionSites (sequence, arrayOfItems, dnaConformation)	{	
	var resultArray = new Array();
	var lookAhead = 50;
	var lowerLimit = 0;
	var upperLimit = sequence.length;
	var shiftValue = 0;
	var cutDistance;
	var matchExp;
	var matchPosition;
	var tempString;
	var backGroundClass;
	var matchArray;
	var timesFound = 0;
	if (dnaConformation == "circular")	{
		shiftValue = (sequence.substring(0, lookAhead)).length;
		sequence = sequence.substring(sequence.length - lookAhead,sequence.length) + sequence + sequence.substring(0,lookAhead);
		lowerLimit = 0 + shiftValue;
		upperLimit = upperLimit + shiftValue;
	}
	outputWindow.document.write ('<table border="1" width="100%" cellspacing="0" cellpadding="2"><tbody>\n');	
	outputWindow.document.write ('<tr><td class="title" width="200px">' + 'Site:' + '</td><td class="title">' + 'Positions:' + '</td></tr>\n');	
	for (var i = 0; i < (arrayOfItems.length); i++)	{
		tempString = "none";
		backGroundClass = "many";
		matchExp = arrayOfItems[i].match(/\/.+\//) + "gi";
		matchPosition = 0;
		matchExp = eval(matchExp);
		cutDistance = parseFloat((arrayOfItems[i].match(/\)\D*\d+/)).toString().replace(/\)\D*/,""));

		while (matchArray = matchExp.exec(sequence)) {
			timesFound++;
			matchPosition = matchExp.lastIndex;
			matchPosition = matchPosition - cutDistance;
			if ((matchPosition >= lowerLimit) && (matchPosition < upperLimit))	{
				tempString = tempString + ', ' + (matchPosition - shiftValue + 1);
			}				
		}		

		if (tempString.search(/\d/) != -1)	{
			tempString = tempString.replace(/none,\s*/,"");
		}

		if (timesFound == 0) {
			backGroundClass = "none";
		}
		else if (timesFound == 1) {
			backGroundClass = "one";
		}
		else if (timesFound == 2) {
			backGroundClass = "two";
		}
		else if (timesFound == 3) {
			backGroundClass = "three";
		}
		else {
			backGroundClass = "many";
		}		

		outputWindow.document.write ('<tr><td class="' + backGroundClass + '">' + ((arrayOfItems[i].match(/\([^\(]+\)/)).toString()).replace(/\(|\)/g,"") + '</td><td class="' + backGroundClass + '">' + tempString + '</td></tr>\n');

		timesFound = 0;
	}
	outputWindow.document.write('</tbody></table>\n');
	return true;
}

function writeSequenceStats (sequence, arrayOfItems)	{	//arrayOFItems are regular expressions. A number included with each regular expression serves as a multiplier for the percentage calculation. Any additional text will appear next to the pattern when the results are given.
	var originalLength = sequence.length;
	outputWindow.document.write ('<table border="1" width="100%" cellspacing="0" cellpadding="2"><tbody>\n');	
	outputWindow.document.write ('<tr><td class="title">' + 'Pattern:' + '</td><td class="title">' + 'Times found:' + '</td><td class="title">' + 'Percentage:' + '</td></tr>\n');	
	for (var i = 0; i < (arrayOfItems.length); i++)	{
		var tempNumber = 0;
		var matchExp = arrayOfItems[i].match(/\/.+\//) + "gi";
		matchExp = eval(matchExp);
		if (sequence.search(matchExp) != -1)	{
			tempNumber = ((sequence.match(matchExp)).length);
		}
		outputWindow.document.write ('<tr><td>' + ((arrayOfItems[i].match(/\([^\(]+\)/)).toString()).replace(/\(|\)/g,"") + '</td><td>' + tempNumber + '</td><td>' + (100 * tempNumber * parseFloat(arrayOfItems[i].match(/\d+/))/originalLength).toFixed(2) + '</td></tr>\n');
	}
	outputWindow.document.write('</tbody></table>\n');
	return true;
}

function writeShuffledSequence (sequence)	{
	var tempSeq = "";
	var tempChar = "";
	var tempString1 = "";
	var tempString2 = "";
	var randNum = 0;
	var maxNum = 0;
	while (sequence.length > 0)	{
		maxNum = sequence.length;
		randNum = Math.floor(Math.random() * maxNum);
		tempChar = sequence.charAt(randNum);
		tempSeq = tempSeq + tempChar;		
		tempString1 = sequence.substring(0,randNum);
		tempString2 = sequence.substring((randNum + 1),sequence.length);
		sequence = tempString1 + tempString2;
		if (tempSeq.length == 60)	{
			outputWindow.document.write(tempSeq +'\n');
			tempSeq = "";
		}
	}
	outputWindow.document.write(tempSeq + '\n');
	return true;
}